Sharing Menangani Anak Demam dan HFMD/Flu Singapore

Hari Minggu 13 Juni 2010  siang, ketika saya dan keluarga besar sedang arisan keluarga di rumah kakak, tiba-tiba Radit mengeluh tidak enak badan, ketika saya pegang badannya panas/demam.

Tindakan saya pertama kali setelah mengetahui anak saya demam adalah MENCARI TERMOMETER. Hal ini diperlukan untuk mengukur berapa suhu tubuh anak kita. Jadi, mengukur suhu tubuh yang akurat itu adalah menggunakan TERMOMETER, bukan meraba dengan tangan kita.

Karena pada saat itu tidak ada termometer, maka hal lain yang segera saya lakukan adalah menenangkan si anak dan mulai memberinya air minum ( cairan untuk mencegah dehidrasi ). Karena Radit ini susah minum air, mau nggak mau saya suapi air minum pakai sendok, SEDIKIT-SEDIKIT tapi SERING. Kebetulan saat itu anaknya masih mau makan, saya suapi makan nasi dengan kuah yang banyak, alhamdulillah masih mau makan banyak.

Untuk bahan referesnsi mengenai DEMAM, ada pada link berikut : http://milissehat.web.id/?p=621

Menjelang magrib, demamnya semakin tinggi, diukur menggunakan termometer 38,6C, anaknya sudah mulai lemas dan sedikit rewel, mulai nggak mau makan ( makan malam cuma sama bolu kukus habis 1 pcs), setelah itu saya minumkna paracetamol sesuai dosis.

Setelah minum paracetamol, Radit tidur….tapi demamnya semakin tinggi, mencapai 39,4C dan seterusnya semakin tinggi sampai paling tinggi 39,8C. Nafasnya menderu-deru, dan beberapa kali menggigil. Saya kompres air hangat di lehar dan selangkangan kaki lalu setiap ada kesempatan saya selalu beri dia air putih (meski hanya seteguk).

Panik? Siapa sih yang nggak panik melihat anaknya sedang demam tinggi dan menggigil seperti itu. Apalagi Radit punya riwayat Kejang Demam ( KD ). Saya dan suami berusaha tetap rasional (kami saling menguatkan). Karena kalau kami panik, hanya akan memperburuk kondisi Radit. Suami saya skin to skin contact dengan Radit, memeluk Radit yang sedang menggigil itu. Cara seperti ini sangat membantu dan membuat Radit nyaman.

Semalaman, demamnya tak kunjung reda, masih di atas 39 C. Karena saya rajin memberinya air minum, Radit sering pipis ( berarti dia tidak dehidrasi ). Sampai keesokan harinya seharian sampai malam, demamnya masih manteng di atas 39 C, meskipun paracetamol tetap saya berikan sesuai dosis. Belum ada batuk pilek ( ini yang membuat saya observasi lebih ketat lagi ), belum dibawa ke dokter ataupun check darah karena demamnya belum 72 jam.

Hari berikutnya, suhu badan mulai turun di kisaran 38,5C, Radit tambah rewel, sakit leher sampai dia nangis-nangis, nggak mau minum, apalagi makan. Ketika saya amati, di dalam mulutnya banyak sariawan sampai di pangkal leher ada sariawan besar. Lalu di tangannya terdapat ruam.

Saya curiga, Radit kena HFMD atau Flu Singapore, berikut penjelasan tentang HFMD :

————————–

—————————————————————————————————–
Flu Singapore Atau Hand Foot Mouth Disease (HFMD)
DEFINISI

“Flu Singapore” sebenarnya adalah penyakit yang di dunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau dalam bahasa Indonesia Penyakit Tangan, Kaki, dan Mulut (PTKM).

Penyakit ini sesungguhnya sudah lama ada di dunia. Berdasar laporan yang ada, kejadian luar biasa penyakit ini sudah ada di tahun 1957 di Toronto, Kanada. Sejak itu terdapat banyak kejadian di seluruh dunia. Di Indonesia sendiri sebenarnya penyakit ini bukan penyakit baru.
Istilah ?Flu Singapore? muncul karena saat itu terjadi ledakan kasus dan kematian akibat penyakit ini di Singapura. Karena gejalanya mirip flu, dan saat itu terjadi di Singapura (dan kemudian juga terjadi di Indonesia), banyak media cetak yang membuat istilah ?flu Singapore?, walaupun ini bukan terminologi yang baku.

PENYEBAB

PTKM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Di dalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab PTKM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.

EPIDEMIOLOGI:

Penyakit ini sangat menular dan sering terjadi dalam musim panas. PTKM adalah penyakit yang kerap terjadi pada kelompok masyarakat yang padat dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya lebih kebal terhadap enterovirus, walau bisa juga terkena.
Penularannya melalui jalur fekal-pral (pencernaan) dan saluran pernapasan, yaitu dari droplet (butiran ludah), pilek, air liur, tinja, cairan vesikel (kelainan kulit berupa gelembung kecil berisi cairan) atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa.
Penyakit ini memberi imunitas spesifik, namun anak dapat terkena PTKM lagi oleh virus strain Enterovirus lainnya.
Masa Inkubasi 2 ? 5 hari.

GEJALA

Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (faringitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulkus di mulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki. Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini umumnya akan membaik sendiri dalam 7-10 hari, dan tidak perlu dirawat di rumah sakit.

Bila ada gejala yang cukup berat, barulah penderita perlu dirawat di rumah sakit. Gejala yang cukup berat tersebut antara lain :
– Hiperpireksia, yaitu demam tinggi dengan suhu lebih dari 39 C. – Demam tidak turun-turun – Takikardia (nadi menjadi cepat) – Takipneu, yaitu napas jadi cepat dan sesak – Malas makan, muntah, atau diare berulang dengan dehidrasi. – Letargi, lemas, dan mengantuk terus – Nyeri pada leher, lengan, dan kaki. – Kejang-kejang, atau terjadi kelumpuhan pada saraf kranial – Keringat dingin – Fotofobia (tidak tahan melihat sinar) – Ketegangan pada daerah perut – Halusinasi atau gangguan kesadaran

Komplikasi penyakit ini adalah :
– Meningitis (radang selaput otak) yang aseptik – Ensefalitis (radang otak) – Myocarditis (Coxsackie Virus Carditis) atau pericarditis – Acute Flaccid Paralysis / Lumpuh Layuh Akut (?Polio-like illness? )

Satu kelompok dengan penyakit ini adalah :

1. Vesicular stomatitis dengan exanthem (PTKM) – Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) – EV 70
3. Acute Lymphonodular Pharyngitis – Cox A 10

DIAGNOSA

LABORATORIUM :
Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dengan cara biakan sel dengan suckling mouse inoculation. Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.

Diagnosa Laboratorium adalah sebagai berikut :

1. Deteksi Virus :
– Immuno histochemistry (in situ)
– Imunofluoresensi antibodi (indirek)
– Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.

2. Deteksi RNA :
RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)

3. Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis PTKM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

PENGOBATAN

1. Istirahat yang cukup
2. Pengobatan spesifik tidak ada, jadi hanya diberikan secara simptomatik saja berdasarkan keadaan klinis yang ada.
3. Dapat diberikan :
– Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus
– Extracorporeal membrane oxygenation.
4. Pengobatan simptomatik :
– Antiseptik di daerah mulut
– Analgesik misal parasetamol
– Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam
– Pengobatan suportif lainnya ( gizi dll )

Penyakit ini adalah self limiting diseases, yaitu dapat sembuh dengan sendirinya, dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.

PENCEGAHAN

PENCEGAHAN DAN PENGENDALIAN PENYAKIT:

Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan kekumuhan dan kepadatan lingkungan; kebersihan (Higiene dan Sanitasi) lingkungan maupun perorangan. Cara yang paling gampang dilakukan adalah misalnya membiasakan selalu cuci tangan, khususnya sehabis berdekatan dengan penderita, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.

Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.

sumber : Pusat Informasi Penyakit Infeksi
http://www.infeksi.com

——————————————————————————————————————————

Dalam artikel tersebut disebutkan bahwa penyakit ini termasuk self limiting diseases, yaitu dapat sembuh dengan sendirinya. Oleh karena itu saya rawat sendiri di rumah.

Lucunya, meskipun tenggorokan dan mulutnya sakit, Radit nggak mau makan bubur, dia tetep minta nasi diberi kuah sop. Sarapan pagi saya beri omelet atau roti+omelet ditambah semangkuk kecil pepaya, makan siang maunya sedikit (nasi+sop) atau makan bolu kukus saja, makan malam juga begitu ( dia maunya makan telor rebus saja ) atau makan bolu kukus, setiap habis makan saya suapi susu dan madu. Makannya sambil nangis-nangis, soalnya memang sakit sekali untuk menelan. Jangankan makan, untuk menelan air minum pun sangt sakit. Selama 4 hari Radit masih susah minum, makan dan nggak mau ngomong, mulutnya dia tutup rapat-rapat.

Hari ini alhamdulillah, Radit sudah mau membuka mulutnya, sudah mau makan lahap (sepertinya si sariawan juga sudah tidak ada), ruam pun tinggal bekasnya saja.

Sembuh ya Radit Sayang……

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s